All tend to have phialides arranged in whorls and to produce whip-like sterile hairs. Trichoderma gillesii is known only from a single teleomorph collection; it is the only species in the clade that has been linked to a teleomorph and possibly is endemic to Isle de la Réunion in the Indian Ocean, although there has been little or no exploration for Hypocrea in East Africa and the Indian Ocean region. There is no practical way to separate T. flagellatum from T. gillesii; conidia of the single collection of T. gillesii are slightly narrower than those of T. flagellatum. 7. Trichoderma ghanense Yoshim. Doi, Y. Abe & J. Sugiy., Bull. Natl. Sci. Mus.

Tokyo Ser. B (Bot.) 13: 3 (1987). = Trichoderma parceramosum Bissett, Can. J. Bot. 69:2418 (1991). ≡ Trichoderma atroviride Bissett, Can. J. Bot. 62: 930 (1984), non P. Karst. Teleomorph: none known Ex-type culture: IAM 13109 SB-715992 = ATCC 208858 = G.J.S. 95–137 Typical sequences: ITS Z69588, tef1 AY937423 This species was first described from soil in Ghana (Doi et al. 1987). Bissett (1984, 1991c) described T. atroviride Bissett (non P. Karst.), later renamed

as T. parceramosum (Bissett 1991c), from soils of North Carolina and Virginia. Kuhls et al. (1997) could not distinguish the Entinostat ex-type PFT�� strains of T. ghanense and T. parceramosum by their ITS sequences and Samuels et al. (1998) synonymized the species. This synonymy was confirmed by the multilocus analysis of Druzhinina et al. (2012). Trichoderma Carbohydrate ghanense has not been reported frequently. Hoyos-Carvajal et al. (2009) did not report it from their survey of soil-inhabiting Trichoderma from South and Central America but we obtained several strains from soil under coffee in Peru and from natural and cultivated soils of Cameroon, Ghana and Nigeria, and a single strain isolated from peat in Italy. A striking aspect of T. ghanense is its tuberculate conidia. As distinctive as it is, there is considerable variation in this character. In most microscope preparations many or most conidia do not have visible tubercles and typically only one or a few tubercles are seen

on individual conidia. The grossly tuberculate conidia described by Doi et al. (1987) for this species are extreme. Conidia of an Italian strain (G.J.S. 05–96) are considerably smaller (4.7 ± 0.5 × 2.5 ± 0.4 μm) than is typical for the species (6.2 ± 0.8 × 3.5 ± 0.4 μm) but in the analysis of Druzhinina et al. (2012) this strain could not otherwise be distinguished within T. ghanense. Trichoderma ghanense is typically a soil species and has not been linked to a teleomorph. We have studied Peruvian strains isolated from trees and fruits of Theobroma cacao (cacao) infected with destructive parasites, respectively Moniliophthora perniciosa (Witches’ Broom Disease) and the pseudostroma of M. roreri parasitizing cacao pods (Frosty Pod Rot). 8. Trichoderma gillesii Samuels, sp. nov. Figs. 9 and 10. Fig.

CrossRefPubMed 25. Castanha ER, Swiger RR, Senior B, Fox A, Waller LN, Fox K: Strain discrimination among B. anthracis and related organisms by characterization of bclA polymorphisms using PCR coupled with agarose gel or microchannel fluidics electrophoresis. J Microbiol Methods 2006, 64:27–45.CrossRefPubMed 26. Ciammaruconi A, Grassi S, De Santis R, Faggioni G, Pittiglio V, D’Amelio R, Carattoli A, Cassone A, Vergnaud G, Lista F: Fieldable genotyping of Bacillus anthracis and Yersinia pestis based on 25-loci Multi Locus VNTR Analysis. BMC Microbiology 2008, 8:21.CrossRefPubMed 27. Marianelli

C, Graziani C, Santangelo C, Xibilia MT, Imbriani A, Amato R, Neri D, Cuccia M, Rinnone S, Di Marco V, Ciuchini F: Molecular epidemiological and antibiotic susceptibility characterization of Brucella isolates selleck kinase inhibitor from humans in Sicily, Italy. J Clin Microbiol

2007, find more 45:2923–2928.CrossRefPubMed 28. Brucella MLVA genotyping[http://​mlva.​u-psud.​fr/​BRUCELLA/​spip.​php?​article74~0026;var_​recherche=​ring%20​trial] 29. MLVAbank for Bacterial Genotyping[http://​mlva.​u-psud.​fr/​] Authors’ contributions RDS and AC did the set up of the Brucella 15-MLVA assay. RDS, AC and CM participated to typing work. FL, RD’A and CM did the error checking analysis. RDS and GF did various sequence analysis. FL and RDS were in charge of the database and clustering analyses. FL, AC, RD’A and RDS conceived the study. FL and RDS wrote the report. All authors read and approved the final manuscript”
“Background The National Center for Biotechnology Information (NCBI) Virus Variation Resources (VVR) provide web retrieval interfaces, analysis and visualization tools for virus sequence datasets. In this paper we describe the recent extension of the collection of resources ZD1839 datasheet to include the Dengue Virus Resource in addition to the existing Influenza Virus Resource [1, 2]. The NCBI Dengue Virus Resource was created to support a collaborative effort by the National Institute of Allergy and Infectious Diseases (NIAID), the Broad Institute, and the Novartis Institute for CRT0066101 datasheet tropical Diseases (NITD) to create a large collection of complete dengue genome sequences and provide access to the sequences

and linked geographic and clinical information. This effort includes the NIAID-funded sequencing of dengue genomes from a wide geographic range by the Broad Institute and its collaborators. The World Health Organization (WHO) estimates that up to 50 million individuals in more than 100 tropical and sub-tropical countries are infected with the mosquito-borne dengue virus (DENV) each year resulting in 500,000 hospitalizations [3, 4]. With improvements in disease identification, reporting and surveillance, the number of reported dengue cases has been increasing in recent decades (Figure 1), as has the geographic range of the virus and its main vector Aedes aegypti, making dengue a growing public health concern, especially in developing nations.

Modest increases in iglA and ripA expression during MK-8931 in vitro intracellular growth were observed only when organisms were propagated in BHI prior to infection. These observations are in line with that of Hazlett et. al. who found that Francisella virulence genes are variably expressed in different types of media, some of which more closely replicate intracellular expression profiles than others [39]. When infected with BHI-grown organisms, F. tularensis ripA and

iglA gene expression changes coincided with the transitions from vacuolar, to early cytoplasmic, and then late cytoplasmic stages of infection. The expression of ripA was repressed during the early stage of infection when the bacteria are reportedly associated with a phagosome MLN2238 mw [13–15]. Expression of both ripA and iglA increased during the early phase of cytoplasmic growth then decreased during the latter stages of infection. The ripA expression levels associated with these sites and stages of intracellular growth corresponded to our observed effects of pH on ripA expression in CDM and the reported pH of the relevant intracellular environment. A number of studies PLK inhibitor have shown that the early Francisella – containing phagosome is acidified prior to bacterial escape [40, 41]. Interestingly,

we found that acidic pH repressed ripA. Additionaly, ripA expression was dispensable for growth at acidic pH in vitro, and was likewise dispensable for survival and escape from the phagosome. The pH of the cytosol of a healthy macrophage is reportedly ca. 7.4. Neutral to mildly basic pH resulted in increased ripA expression in vitro. The ripA deletion mutant was defective for growth both at neutral pH in vitro, and within the cytoplasm of host cells. Finally, the pH of the cytosol during late stages of Francisella infection has not been measured, however during apoptosis the pH reportedly drops to 5.8 [42]. Since Francisella has been demonstrated to induce apoptosis in macrophages [43] this might explain, Thalidomide at least in part, the drop in ripA expression during the late stage of

infection. We are currently investigating the scope and mechanisms of pH associated gene regulation in Francisella and its role in host cell adaptation and virulence. Given that growth media and the stage of infection had similar affects on iglA and ripA expression we thought it reasonable to determine if the two genes were subject to the same or overlapping regulatory mechanism(s). Earlier microarray and proteomic [22–25] analyses revealed that the expression of iglA and IglA, respectively, as well as a number of other genes and proteins, are regulated by two related transcriptional regulators, MglA and SspA [23, 44]. Transcriptional profiling studies of mglA and sspA mutant strains by microarray [23] gave no indication that either of these regulators affected ripA expression. However, in complementary proteomic studies, RipA (FTN_0157) was present in 2 – fold higher amounts in a F. novicida mglA mutant strain as compared to wild type [25].

Inset: the device structures. Table 1 Summary of EL performance of all WOLEDs in this study   V on a(V) CEmax b(cd/A) PEmax c(lm/W) CEdat 1,000 cd/m2(cd/A) PEeat 1,000 cd/m2(lm/W) CIE at 10 V ( x , y ) Reference device 3.52 10.7 5.5 10.6

5.2 (0.38, 0.45) Device A 3.56 16.4 8.3 16.2 8.1 (0.32, 0.45) Device B 3.76 11.0 4.4 10.9 4.2 (0.32, 0.45) Device C 3.82 8.1 3.5 8.0 3.1 (0.24, 0.35) aTurn-on voltage; bmaximum current efficiency; cmaximum power efficiency; dcurrent efficiency at 1,000 cd/m2; epower efficiency at 1,000 cd/m2. Figure 3 The schematic energy selleck products level diagram of WOLEDs with the portion of EMLs. (a) device A. (b) device B. (c) device C. Black circle and white circle express electron and hole, respectively. The numbers indicate the OSI-027 cost LUMO and HOMO energies relative to vacuum (in eV). Here, LUMO and HOMO are cited from [18–20]. Figure 4 The EL spectra of all WOLEDs under various voltages. (a) Reference device, (b) device A, (c) device B, and (d) device C. Another two MQW structure WOLEDs have low efficiencies compared to device A, even lower than that of the reference device. Devices A, B, and C offer a peak luminance of 17

700, 13,200, and 8,489 cd/m2, respectively. The difference between luminances indicates the different recombination efficiencies because luminance is generally decided by the recombination degree between electrons and holes [21]. Table 1 summarizes the EL performances of all devices. Such a large difference between their EL performances could be understood from different alignments between LUMO/HOMO energy levels of EML/PBL due to the use of different PBL materials. First, let us see the schematic energy level diagrams of WOLEDs with the portion of EMLs that are shown in Figure 3. Device A with TPBi as PBL belongs to the Torin 2 manufacturer foregoing type-I MQW structure, and LUMO/HOMO energy levels (bandgap) of each EML located within LUMO/HOMO energy levels of TPBi and

two carriers are confined in the EML, while devices B and C belong to the type-II MQW structure with Bphen and BCP as PBL, respectively. The LUMO/HOMO Digestive enzyme energy levels of PBL and EML are staggered, and only a single carrier is confined in the EML. For device A, there is a 0.2-eV barrier at the interface of either [LUMO]EML/[LUMO]TPBi or [HOMO]EML/[HOMO]TPBi, and such an energy level alignment makes electrons and holes distribute uniformly in the EMLs that act as potential wells under electrical excitation. All the electrons and holes could be confined in EMLs due to the presence of a suitable energy level of TPBi, which would increase a recombination possibility between the two carriers and produce more excitons in EML [22]. For device B, the potential well of holes is the EML with a 0.4-eV barrier at the [HOMO]EML/[HOMO]Bphen interface; injected holes could easily be confined within the HOMO energy level of EML.

Interestingly, 61% of women operated for breast cancer (cases) with HOMA-IR ≥ 2.5 presented fasting

plasma glucose levels and fasting plasma insulin levels in the normal range (group 1). Only 5% of cases showed high levels of both fasting plasma glucose and fasting plasma insulin (group 2). 7% were euglycemic, but plasmatic insulin levels were high (group 3). 27% of patients presented as hyperglycaemic, but insulin levels were in the normal range (group 4). Discussion Our data still confirm the existing linkage between metabolic alterations and breast cancer. Higher prevalence of MS (35%) among postmenopausal women with breast cancer compared click here to healthy women (19%) [OR 2.16] was found. No statistical significant difference in premenopausal women was found. Probably, alterations in metabolic signalling that activate pro-mitotic and anti-apoptotic pathways are more likely to occur in postmenopausal women. Moreover all MS features were positively, but RXDX-101 weakly associated to breast cancer risk. As expected from the recent literature, android fat distribution-consisting in WC >88 cm- was positively associated to MS and breast cancer more than BMI. Waist circumference >88 cm was measured in 53% of cases – OR 1.58 (95% CI 0.8-2.8) and in 46% of controls, whereas no differences in BMI were found between cases and controls. A majority of prospective studies show breast cancer risk to be

higher in obese postmenopausal women with upper abdominal adiposity than in those with overall adiposity. The evidence is more limited and inconsistent in the case of premenopausal women. Overall adiposity in women adversely affects breast cancer risk mainly by greater exposure of mammary epithelial tissue DNA ligase to endogenous oestrogen and to pro-inflammatory cytokines. Upper abdominal adiposity appears to involve an additional effect related to the presence of insulin resistance [15]. Waist circumference measurement reveals to be more accurate than BMI alone in breast cancer risk A-1210477 in vitro evaluation. Second end point of our study was to singularly analyze insulin resistance contribution in determining breast cancer risk. 49% of cases were insulin resistant respect to 34% of controls

[OR 1.86], suggesting that insulin resistance can nearly double the risk of breast cancer development. 80% of the insulin resistant patients were postmenopausal, but the most important aspect to consider is that 61% of women operated for breast cancer (cases) with HOMA-IR ≥ 2.5, and so to be considered as insulin resistant, presented fasting plasma glucose levels and fasting plasma insulin levels in the normal range, whereas 7% of patients were euglycemic, but plasmatic insulin levels were high. Consequently 68% of patients had levels of fasting plasma glucose in the normal range, and, similarly, fasting plasma insulin levels were diagnosed as normal in 88% of cases. Only through the use of HOMA score were we able to diagnose insulin resistance.

In contrast, the membrane-bound FtsH protease was only detected in the membrane fraction of both strains analyzed (not shown). Taken together, these results showed that cells displaying increased expression of σFAZD0156 solubility dmso -dependent genes accumulate this sigma factor in the cytoplasm. Figure 6 Subcellular localization of σ F . Immunoblot assays selleck compound performed with membrane and soluble fractions obtained from parental strain NA1000 (WT) and a CC3252 mutant with both cysteine residues

C131 and C181 replaced for serine (C131-181S). Aliquots were taken immediately before or after cells were treated with 55μM potassium dichromate (K2Cr2O7) for 30min. Membrane and soluble fractions were obtained as described in Methods. Copanlisib cost Blots were developed using anti-σFantiserum and fluorescent CF680 Goat Anti-Rabbit IgG. σF is shown by an arrow. Neither σF nor σF-dependent genes CC2906 and

CC3255 are essential for Caulobacter resistance to metal stress To investigate the requirement of sigF for resistance of C. crescentus cells to dichromate or cadmium, the sensitivity of the parental strain and the sigF deletion mutant to exposure to these metals was monitored. Both strains displayed similar sensitivity profile to dichromate or cadmium (data not shown), suggesting that sigF is not essential for bacterial survival under this stress condition. As the deduced protein sequences of CC2906 and CC3255 are highly similar, we constructed a single deletion mutant strain in each gene (SG19 and SG20) as well as a double mutant (SG21) and tested the resistance of these strains to the metal stresses. Similar to what was found for the sigF deletion mutant, no increased sensitivity was observed for these mutant strains following Thiamine-diphosphate kinase exposure to either dichromate or

cadmium, when compared to parental cells (data not shown). Together, these data suggest that σF-mediated transcriptional response to chromium or cadmium is not essential for survival of C. crescentus to exposure to these metal ions. Discussion In this report, we clearly show that C. crescentus σF is involved in the transcriptional response to chromium and cadmium in an oxidative stress independent manner. Transcriptome analysis of cells under dichromate stress revealed that σF controls a small regulon comprised of eight genes, which are distributed in three transcriptional units. Although a conserved domain was predicted for the deduced protein sequence of all σF-dependent genes, only two of these sequences could be assigned to a possible function. The protein encoded by CC2748 belongs to the group of sulfite oxidases, which catalyze the oxidation of the toxic and very reactive sulfite to the inert sulfate anion [22]. The product of CC3257 is a member of the DoxX family.

The dividable curve reveals that the T c of the sample is above 300 K. Furthermore, there is no blocking temperature in this temperature range, indicating that the observed RTFM is an intrinsic attribute rather than caused by ferromagnetic impurities Cilengitide molecular weight [36, 37]. The M H curves for sample S1 measured at different temperatures from 10 to 300 K are shown in Figure 5b. The diamagnetic signal due to the sample holder was

subtracted, and the magnetization was saturated at about 3,000 Oe. It can be seen that the M s decreases with the increasing temperature. What’s more, the sample shows considerable hysteresis, and the coercive field decreases in a monotonic fashion from a value of 210 Oe at 10 K to 69 Oe at 300 K, which is a typical ferromagnetic behavior.

Figure 5 Magnetic characteristics of sphalerite CdS NSs represented by lines of different colors. (a) Room-temperature M-H curves of samples S1 to S4. The inset selleck chemicals llc shows ZFC and FC curves with a dc field of 100 Oe applied on sample S1. (b) M-H curves for sample S1 measured at different temperatures. (c) ESR spectra of sample S1 measured from 90 to 300 K. (d) The calculated ΔH which is H center is far from 321 mT (g = 2.0023) and the www.selleckchem.com/products/KU-55933.html variation of M s at different temperatures for the same sample (S1). ESR was performed to further characterize the magnetic properties of the sphalerite CdS NSs. Figure 5c depicts the ESR results measured 4��8C at different temperatures from 90 to 300 K for sample S1. It can be seen that the sample shows resonance signals with applied magnetic field from 0 to 500 mT. The center magnetic fields (H center) for the sample are far from 321 mT which characterize a free electron (g = 2.0023), indicating that the sample has obvious FM [38],

and the ferromagnetic coupling between the moments increase with the decreasing temperature. According to the theory of ferromagnetic resonance [38], the relationship between resonance field and microwave frequency in the ferromagnetic resonance is hν = gμ B · H, where h, ν, g, μ B, and H are the Planck constant, frequency of the applied microwave magnetic field, g-factor, Bohr magnetron, and resonance magnetic field, respectively. In FM materials, the orbital angular momentum quenching in the crystal field and g-factor is 2.0023; the resonance field is made up of applied field H a and magnetocrystalline anisotropy field H k: H = H a + H k. If we define H a as H and attribute the change of H k to the g-factor, which is defined as an effective g-factor (g eff), then the ferromagnetic resonance relationship changes to hν = g eff μ B · H a. H k will increase with the decreasing temperature, and then g eff will get higher. In sample S1, the g eff increases from 2.54 to 2.74 as the temperatures decrease from RT to 90 K.

In addition, collaboration with renal medicine is essential to avoid introduction of dialysis. Also we should consider how we could help patients by treatment to live long actively in the society. Open Access This article is distributed under the terms of the Creative Commons Attribution License which permits any use, distribution,

and reproduction in any medium, provided the original author(s) and the source are credited. References 1. Dispenzieri A, et al. Treatment of newly diagnosed multiple MLN4924 cost myeloma based on Mayo Stratification of Myeloma and Risk-adapted Therapy (mSMART): consensus statement. Mayo Clin Proc. 2007;82:323–41.PubMed 2. Bergsagel DE, et al. Myeloma proteins and the clinical response to melphalan therapy. Science. 1965;148(3668):376–7. 3. Salmon SC, et al. Intermittent

selleck chemicals llc high dose prednisone therapy for multiple myeloma. Cancer Chemother Rep. 1967;51:179–87.PubMed 4. Alexanian R, et al. Treatment for multiple myeloma. Combination chemotherapy with different melphalan dose regimens. JAMA. 1969;208(9):1680–5.PubMedCrossRef 5. Kyle RA, et al. A long-term study of prognosis click here in monoclonal gammopathy of undetermined significance. N Engl J Med. 2002;346:564–9.PubMedCrossRef 6. San Miguel JF, et al. Bortezomib plus melphalan and prednisone for initial treatment of multiple myeloma. N Engl J Med. 2008;359(9):906–17. 7. Kumar SK, et al. Improved survival in multiple myeloma and the impact of novel therapies. Blood. 2008;111(5):2516–20.PubMedCrossRef 8. Hideshima T, et al. Intracellular protein degradation and its therapeutic implications. Clin Cancer Res. 2005;11(24 Pt 1):8530–3.PubMedCrossRef 9. Fayers PM, et al. Thalidomide for previously untreated elderly patients with multiple myeloma: meta-analysis of 1685 individual patient data from 6 randomized clinical trials. Blood. 2011;118:1239–47.PubMedCrossRef 10. Richardson PG, et al. Bortezomib or high-dose dexamethasone for relapsed multiple myeloma. N Engl J Med. 2005;352(24):2487–98. 11. San Miguel JF, et

al. ASH2011. http://​myeloma.​org/​pdfs/​ASH2011_​San%20​Miguel_​3619.​pdf. 12. Suzuki K. Discovery research on the effects of giving continuity to the administration of bortezomib in maintenance therapy to target of relapsed and refractory multiple myeloma. J New Rem Clin. Reverse transcriptase 2012;61:1259–69. 13. Durie BGM, et al. International uniform response criteria for multiple myeloma. Leukemia. 2006;20(9):1467–73. 14. Niesvizky R, et al. The relationship between quality of response and clinical benefit for patients treated on the bortezomib arm of the international, randomized, phase 3 APEX trial in relapsed multiple myeloma. Br J Haematol. 2008;143(1):46–53.PubMedCrossRef 15. Harousseau JL, et al. The role of complete response in multiple myeloma. Blood. 2009;114(15):3139–46.PubMedCrossRef 16. Chanan-Khan A, et al. Importance of achieving a complete response in multiple myeloma, and the impact of novel agents. J Clin Oncol. 2010;28(15):2612–24.PubMedCrossRef 17.

Glucose-dependent, CcpA-dependent genes All genes found to be subject to regulation by glucose in a CcpA-dependent way are depicted in the Additional files 3: CcpA dependent down-regulation by glucose, and 4: CcpA-dependent up-regulation by glucose. For consistency reasons, a few genes which were not meeting the arbitrary threshold, such as SA0605 or SA0299 (indicated by a paragraph), were included, since these genes are part of putative operons and showed a tendency towards regulation. As before, only a minor part of the affected genes/operons (48 out of 155) contained putative Vactosertib cre-sites in their promoter regions, indicating a

direct control by CcpA, while the majority of genes seemed to be controlled by CcpA in a way that did not involve the interaction PLX-4720 datasheet with an apparent cre-site. Grouping the regulated genes into functional categories according to the selleck screening library DOGAN annotation [26] and/or KEGG database [27] showed that unknown proteins represented again the largest regulated category (39 genes), followed by transport/binding

proteins and lipoproteins (22 genes), metabolism of amino acids (19 genes), and metabolism of carbohydrates (17 genes) (Fig. 3B). CcpA-independent regulation by glucose We found a small group of genes, encoding the 6-phospho-betaglucosidase, the putative ascorbate transport- and the lactose-operon, to be regulated by glucose in an apparently CcpA-independent way (Table 2). The lactose operon, reported to be controlled by catabolite repression [28] requires intracellular galactose-6-phosphate for induction [29]. The lack of specific inducer

under the conditions used here may have obscured the CcpA-dependent regulatory effects on the lac- and other operons, or mechanisms accounting for CcpA-independent catabolite control may be active [9]. Again, the table includes a few genes not meeting the arbitrary threshold (indicated by a paragraph), which were nevertheless listed, since they are likely to form part of putative operons and showed a tendency towards regulation DOK2 that was consistent with the other member(s) of these operons. Table 2 Genes/operons with CcpA-independent regulation by glucose ID   Producta wt mut N315 Newman common   +/- b +/- b Down-regulated by glucose SA0256 NWMN_0200 bglA 6-phospho-beta-glucosidase 0.5 0.5 SA0318 NWMN_0322   ascorbate-specific PTS system enzyme IIC 0.1 0.3 SA0319 NWMN_0323   similar to PTS system component 0.2 0.2 SA0320 NWMN_0324   similar to PTS transport system IIA component 0.2 0.2 SA0321 NWMN_0325   similar to PTS multidomain regulator 0.3 0.2 SA1991 NWMN_2093 lacG 6-phospho-beta-galactosidase 0.5 0.5 SA1992 NWMN_2094 lacE PTS system, lactose-specific IIBC component 0.5 0.4 SA1993 NWMN_2095 lacF PTS system, lactose-specific IIA component 0.4 0.

g. NickR-binding sites in the region). The complete ure2 operon is thus composed of thirteen genes putatively involved in three different functions, namely urease production, urea transport, and Momelotinib in vitro nickel transport. Table 1 Oligonucleotides RT PCR   Gene set RT_BAB1_1374_BamHI.F GGATCCACACGCGATTTCCTTTCATC 1 RT_ureA2_BamHI.R GGATCCCATCACCTCTTCGACGGTTT find more 1, 2 RT_BAB1_1375.F AAGGTCCTGCCAGTACAACG 2 RT_ureA2.F AAACCGTCGAAGAGGTGATG 3 RT_ureC2.R

CGCAGATCCTTCTCGATTTC 3 RT_ureC2.F ACAGTCGATCTCGCTCAACC 4 RT_BAB1_1381.R CTTGATAAGGATTGGCACGA 4 RT_BAB1_1381.F ACCTGATCCGTGAAAACGTC 5 RT_BAB1_1383.R GAAAGAACAGTCCCGTCAGC 5 RT_BAB1_1383.F GGATACAACCAAGCCTGCAT 6 RT_BAB1_1386.R GGCATTGCGGATGATAAGTT 6 RT_BAB1_1386.F GCTTTTTCTCTGGGCCAAAT 7 RT_BAB1_1388.R GACAGGGAAAGCTTGTCGAG 7 ΔureT     U_BMEI0642_XbaI.F TCTAGAGACCCAGACCATAACGCTTG   U_BMEI0642_BamHI.R GGATCCCTGCCATGGAGGCCTCCT   BMEI0642.F AGGAGGCCTCCATGGCAGGGATCCCCTGAGCCTGATTTCTGGA   D_BMEI0642_PstI.R CTGCAGGACCGATCCGTCATTGACAT   aphT     aphT.F ATACTGCAGATTAGAAAAACTCATCG   aphT.R TCACACAGGAAACAGCTATG   ΔnikO     BAB1_1388 XbaI.R ACGTTCTAGACAATATCTGCGTGCTCTCCA   RT_BAB1_1388.R GACAGGGAAAGCTTGTCGAG   BAB1_1388 BglII.F CTCGACAAGCTTTCCCTGTCAGATCTCCACCTGCATTATGTCGAG   BAB1_1388 PstI.R ACGTCTGCAGCATTATCGATAGCGGCCTTG   EPZ015938 manufacturer Figure 1 Evidence of transcription

and redefinition of the ure2 operon of Brucella abortus 2308. The map on top of the figure shows the ure2 region of the large chromosome of Brucella abortus 2308. Below the map the arrows indicate primers designed to check transcription of the region. For each pair of primers marked with a number, three separate PCR reactions were performed: a positive control using genomic DNA as template; a test reaction using cDNA as template, and a control using RNA as template. M, 1 Kb Plus DNA ladder. Construction of chromosomal mutants in the ure2 operon In order to analyze the impact of the ure2 genes on urease activity, we constructed three mutants as described

in the Methods section: i) a polar mutant created by replacing part of ureT with a kanamycin resistance gene that has a transcriptional termination signal (ΔureTp), ii) a non-polar mutant lacking the aph transcriptional terminator, which only affects ureT function (ΔureT), and iii) a ΔnikO mutant, affecting the ATP binding protein of the putative nickel transport system ZD1839 encoded by nikO, the last gene of the operon, and predicted to have the biggest impact on the correct function of the transporter while still maintaining basal activity [16]. Urease activity of the different ure2 mutants Urease activity was measured in crude protein extracts from the mutants and the wild type strain. The results in Figure 2A show that extracts of both the ΔureTp and ΔnikO mutants had their urease activity reduced to about 50% of the activity observed in the wild type strain 2308, while the urease activity was rather unaffected in the ΔureT mutant.