In addition, there are now also RCTs of click here statins in patients with CKD. The Assessment of LEscol in Renal Transplantation was a double-blind RCT of fluvastatin in 2102 kidney transplant recipients with serum cholesterol 4.0–9.0 mmol/L at least 6 months after transplantation [16]. The primary endpoint, major adverse buy Ruboxistaurin cardiac events (MACE), was not significantly different (P = 0.139) between the two groups, but important secondary endpoints were better with fluvastatin. In addition, after longer follow-up, the differences in MACE were statistically significant [17]. Interestingly,

Die Deutsche Diabetes Dialyse (4-D) Studie [18], and the Study to Evaluate the Use of Rosuvastatin in Subjects on Regular Hemodialysis: An Assessment of Survival and Cardiovascular Events (AURORA) [19], both failed to produce reductions in MACE. A number of explanations have been given for these surprising results, including the possibility that many MACE were not atherosclerotic. The Study of Heart and Renal Protection enrolled 9270 patients with CKD (3023 on dialysis and 6247 not on dialysis) with no known history of myocardial infarction or coronary revascularization [20]. The primary endpoint, MACE, was reduced by treatment with simvastatin www.selleckchem.com/products/Pazopanib-Hydrochloride.html 20 mg combined with ezetimibe 10 mg. Interestingly, in a subgroup analysis, there was no difference in MACE among dialysis patients. Also notable was the fact

that pre-specified endpoints of CKD progression among those not on dialysis at enrollment were not significantly different between the two groups. In light of the several RCTs of statins in patients with CKD,

at least two meta-analyses have been conducted [21, 22]. Although the two meta-analyses differed in design and in which studies were included, their results were Mirabegron very similar. They concluded that statins reduce the risk of CVD and all-cause mortality in CKD Stage 3–5, that evidence for benefit in dialysis patients is lacking, and that evidence for benefit after transplant is sparse. There was some evidence that statins may slow the progression of CKD, but this evidence was not conclusive. Guidelines for treatment of dyslipidemia in CKD Since there is now a substantial body of evidence from intervention trials in CKD, the Kidney Disease Global Outcomes (KDIGO) group convened an evidence review team and guideline work group to develop a clinical practice guideline [23]. The work group has produced a guideline that suggests treating CKD patients (not on dialysis) who are at risk for cardiovascular disease with a statin. Patients on dialysis need not start a statin, but they may continue to receive a statin if they were taking a statin before dialysis initiation. Summary This conference demonstrated that studying the relationship between lipid abnormalities and outcomes in patients with CKD remains a fruitful area of study.

The goal for these new anti cancer strategies would be to take advantage of the cancer cell defects in repairing their own DNA and use it as an Achille’s heel to enhance therapeutic

indices, with limited normal tissue toxicity. Among these new compounds, PARP inhibitors have been shown to be highly lethal to tumor cells with deficiencies in DDR factors such as BRCA1 or BRCA2 [1, 2]. The mechanism underlining this approach is based on the concept of synthetic lethality first described in the fruit fly Drosophila [3, 4] and subsequently translated into an efficient method to design novel anticancer drugs [5, 6]. Synthetic lethality centers on targeting two separate molecular pathways that are nonlethal when disrupted individually, but are lethal when inhibited simultaneously [7]. In the case of PARP inhibitors and BRCA1/2 selleckchem mutations, the two molecular pathways whose concomitant inactivation promotes a synthetic lethal relationship are the basic excision repair (BER), responsible for the repair of single-strand DNA breaks (SSBs), and the homologous recombination (HR), that repairs double strand DNA breaks (DSBs). In particular, BER inactivation by PARP inhibitors induces SSBs

CHIR-99021 in vivo that during DNA replication cause lethal breaks in both DNA strands. In normal cells, the latter breaks are repaired by HR, but in tumor cells in which HR is defective, such as in the presence of BRCA1/2 mutations, DSBs are not repaired and their accumulation causes cell

death [1, 2]. These original observations have led to PARP inhibitors entering subsequent phase II clinical trials in breast and ovarian cancer patients, with or without BRCA mutations [8–10]. At present, the data from clinical studies are not as favorable Methane monooxygenase as promised by the preliminary results [11, 12]. Though there might be various causes explaining the clinical performance of the different PARP inhibitors, one of the challenging issues remains on how to identify those patients most receptive to these treatments [13]. Deficiency in several DDR factors other than BRCA1/2 belonging, directly or indirectly, to the HR repair pathway have been shown to sensitize tumor cells to PARP inhibition [14] and synthetic lethal-siRNA screens have Dinaciclib identified ATM among the genes whose depletion might mediate the sensitivity to PARP inhibitors [15]. Recently, ATM-deficient mantle cell lymphoma, chronic lymphocytic leukemia, and T-prolymphocytic leukemia have been shown to be more sensitive to PARP inhibitors than ATM-proficient cells [16, 17] suggesting that ATM mutation/inactivation might predict responses of individual tumors to PARP inhibitors.

J Natl Cancer Inst 94:437–446PubMed 40. Cho E, Smith-Warner SA, Spiegelman D et al (2004) Dairy foods, calcium, and colorectal cancer: a pooled analysis of 10 cohort studies. J Natl Cancer Inst 96:1015–1022PubMed 41. Shaukat A, Scouras this website N, Schunemann HJ (2005)

Role of supplemental calcium in the recurrence of colorectal adenomas: a metaanalysis of randomized controlled trials. Am J Gastroenterol 100:390–394PubMed 42. Bond JH (2000) Polyp guideline: diagnosis, treatment, and surveillance for patients with colorectal polyps. Practice Parameters Committee of the American College of Gastroenterology. Am J Gastroenterol 95:3053–3063PubMed 43. Wactawski-Wende J, Kotchen JM, Anderson GL et al (2006) Calcium plus vitamin D supplementation and the risk of colorectal cancer. N Engl J Med 354:684–696PubMed 44. Weingarten MA, Zalmanovici A, Yaphe J (2008) Dietary calcium supplementation for preventing colorectal cancer and adenomatous

polyps. Cochrane Database Syst Rev CD003548 45. Shin MH, Holmes MD, Hankinson SE, Wu K, Colditz GA, Willett WC (2002) Intake of dairy products, calcium, and vitamin d and risk of breast cancer. J Natl Cancer JQEZ5 datasheet Inst 94:1301–1311PubMed 46. Lin J, Manson JE, Lee IM, Cook NR, Buring JE, Zhang SM (2007) Intakes of calcium and vitamin D and breast cancer risk in women. Arch Intern Med 167:1050–1059PubMed 47. McCullough ML, Rodriguez C, Diver WR, Feigelson HS, Stevens VL, Thun MJ, Calle EE (2005) Dairy, calcium, and vitamin D intake and postmenopausal breast cancer risk in the Cancer Prevention Study II Nutrition Cohort. Cancer Epidemiol Biomarkers Prev 14:2898–2904PubMed 48. Larsson SC, Bergkvist L, Wolk A (2009) GDC-0973 research buy Long-term dietary calcium intake and breast cancer risk in a prospective

cohort of women. Am J Clin Nutr 89:277–282PubMed 49. Rodriguez C, McCullough ML, Mondul AM, Jacobs EJ, Fakhrabadi-Shokoohi D, Giovannucci EL, Thun MJ, Calle EE (2003) Calcium, dairy products, and risk of prostate cancer in a prospective cohort of United States men. Cancer Epidemiol Biomarkers Prev 12:597–603PubMed 50. Mitrou PN, Albanes D, Weinstein SJ, Pietinen P, Taylor PR, Virtamo J, Leitzmann MF (2007) A prospective study of dietary calcium, dairy products and prostate cancer risk (Finland). Int J Cancer 120:2466–2473PubMed Nabilone 51. Giovannucci E, Liu Y, Platz EA, Stampfer MJ, Willett WC (2007) Risk factors for prostate cancer incidence and progression in the health professionals follow-up study. Int J Cancer 121:1571–1578PubMed 52. Hedlund TE, Moffatt KA, Miller GJ (1996) Stable expression of the nuclear vitamin D receptor in the human prostatic carcinoma cell line JCA-1: evidence that the antiproliferative effects of 1 alpha, 25-dihydroxyvitamin D3 are mediated exclusively through the genomic signaling pathway. Endocrinology 137:1554–1561PubMed 53. Koh KA, Sesso HD, Paffenbarger RS Jr, Lee IM (2006) Dairy products, calcium and prostate cancer risk. Br J Cancer 95:1582–1585PubMed 54.

The position

of each primer used in this study is shown. (B) Scheme of the gplH deletion cassette-delivery suicide Y-27632 clinical trial vector used for construction of Ms ΔgplH. The gplH deletion leaves behind a gene remnant coding for only the first 13 (black print) and last 4 (white print) amino acids of GplH. This gene remnant in ΔgplHc is flanked by ~1 kb of downstream and upstream WT sequence for homologous recombination with the chromosome. (C) Agarose gel electrophoresis showing PCR-based confirmation of the gplH deletion in Ms ΔgplH. Lanes: 1, Ms WT (2,239-bp amplicon expected with primers pepOF and pepOR); 2, Ms ΔgplH (2,068-bp amplicon expected with primers pepOF and pepOR); 3, Ms WT (278-bp amplicon expected with primers pepF and pepR); 4, Ms ΔgplH (101-bp amplicon expected with primers pepF and pepR); L, DNA ladder marker. The gplH deletion was engineered using the selleck compound gplH deletion cassette-delivery suicide vector p2NIL-GOALc-ΔgplH c(~16 kb, Figure 4B) in a homologous recombination- ATM/ATR signaling pathway and counter selection-based approach that replaced gplH by a 17-codon gene remnant cloned into the vector. The deletion in Ms ΔgplH encompassed 59 central amino acids of the predicted MbtH-like protein encoded by gplH (GplH, MSMEG_0399; 76 amino acids, Figure 3A). The deletion was verified by PCR using primer pairs that produced amplicons of different sizes depending on whether the genomic DNA used as PCR template was

wild type (WT) or carried the gene deletion (Figure 4C). The successful engineering of Ms ΔgplH set the stage for probing the involvement of gplH in GPL production. The gene gplH is essential for GPL production We investigated the effect of the gplH deletion in Ms ΔgplH on GPL production using TLC and MS analyses. In addition, a control strain for genetic complementation analysis was constructed (Ms ΔgplH + pCP0-gplH), and the ability of this strain and that of

Ms WT controls to produce GPLs was investigated. Representative results from the TLC analysis are shown in Figure 5. The analysis Dynein of lipid extracts from the parental Ms WT strain, or Ms WT bearing the empty pCP0 vector, revealed the expected production of GPLs in these WT controls. Conversely, analysis of lipid extracts from Ms ΔgplH did not reveal detectable amounts of GPLs. Transformation of Ms ΔgplH with pCP0-gplH (a pCP0-based plasmid expressing gplH) rendered the strain Ms ΔgplH + pCP0-gplH, for which TLC analysis demonstrated that production of GPLs was restored to levels comparable to those seen in the WT controls. In contrast, Ms ΔgplH retained its GPL deficient phenotype after transformation with empty pCP0 vector (strain Ms ΔgplH + pCP0). The results of our complementation analysis rule out the possibility that the GPL deficient phenotype observed in Ms ΔgplH is due to a polar effect of the gplH deletion on downstream genes required for GPL production (i.e., mps1 and mps2; Figure 2). Figure 5 Deletion of gplH leads to GPL deficiency.

Despite the efforts to identify a genotype definitely associated with the EAEC virulence, controversial data gathered in different geographic areas has made the epidemiology of this pathotype difficult to SAHA HDAC price understand. Nevertheless, EAEC has been recognized as an emerging pathogen mainly associated with persistent infantile diarrhea in middle-income countries [9, 10]. Elucidation of the mechanisms involved in EAEC pathogenesis has been limited because of the heterogeneity displayed by wild-type strains [6, 11]. Given this genetic heterogeneity, expression of biofilms has been considered a consensual virulence factor among

EAEC isolates [1, 12, 13]. Biofilm formation is a complex event that may involve many species and several factors. Furthermore, the discovery that factors not devoted to adhesion are also important in biofilm formation check details has highlighted its multifactorial nature. An AAF-independent mechanism for biofilm formation, which is mediated by plasmid-encoded type IV pili, was described in the atypical EAEC strain C1096 [14]. Type IV pili are involved in numerous phenotypes in gram-negative pathogens including cell adhesion, twitching motility and conjugation [15, 16]. In addition to type IV pili, tra gene-encoded pili are involved in bacterial conjugation mediated by F plasmids. These cellular appendages are non-bundle forming, flexible pili reaching 5 μm

in length that are expressed during log phase [17–19]. Furthermore, F pili render planktonic bacteria capable of engaging in biofilm formation by allowing cell-to-cell contact

and interactions with abiotic surfaces [20]. Thus, it has been shown that E. coli strains harboring natural F plasmids form complex mature biofilms by using F-pilus connections in initial stages of the biofilm formation, whereas plasmid-free strains form only patchy biofilms [21]. Bacteria that express conjugation systems frequently exhibited cell aggregation followed by flocculation in static liquid culture. In E. coli strains, bacterial autoaggregation is also mediated by the expression of the self-recongnizing this website selleck products adhesin named antigen 43 (Ag43). Ag43 is a autotransporter protein whose the mature form consists of two subunits, α and β [22]. The expression of Ag43 is phase variable and in the K12 strain is under the control of OxyR, the master activator of the oxidative stress response in E. coli strains [23]. In addition to Ag43, bacterial aggregation is also mediated by the expression of curli fibers. Curli is a proteinaceous component of the extracellular matrix produced by many Enterobacteriaceae species which is known as thin aggregative fimbriae [24]. Among Enterobacteriacea species, curli fibers are the major determinant of cell-cell interactions and adherence to abiotic surfaces and have been shown to sustain biofilm formation in Enterobacter sp., Salmonella Typhimurium, E.

Poster No. 173 Tumor Infiltrating Lymphocyte Migration trough HEV Like Vessels Ludovic Martinet 1 , Ignacio Garrido1, Philippe Rochaix2, Jean-Philippe Girard1 1 Cancer biology department, Institut de Pharmacologie et de Biologie Structurale- CNRS UMR 5089, Toulouse, France, 2 anatomopathology department, Institut Claudius Régaud, Toulouse, France The degree of cytotoxic T lymphocyte infiltration is highly correlated with the clinical outcome of cancer patients. Tumor antigen specific T lymphocyte migration from the circulation into tumor tissues is tightly controlled by endothelial

cells expression of multiple receptors such as integrins and vascular selectins. Analysis of tumor endothelium / leukocyte interaction could allow the development of novel approaches Selleckchem GDC-941 to improve the number of tumor infiltrating lymphocytes and immune therapy. Our group has more than 15 years expertise in the molecular characterisation of High endothelial venules (HEVs), Mizoribine mouse specialized post-capillary venules found in lymphoid tissues that mediate high levels of naïve T lymphocyte recruitment from the blood. HEV-like vessels that are similar to HEVs from lymphoid tissues,

also appear in chronically inflamed tissue and have been proposed to participate in the amplification and maintenance of chronic inflammation in auto-immune diseases. In collaboration with the Institute Decitabine purchase Claudius Regaud, we recently identified in human tumor tissues from melanoma, ovary and breast carcinoma patients, venules with HEV-characteristics. Like

their lymph node counterparts, tumor HEVs display a cuboidal shape and express functional PNads (Peripheral node adressins) allowing the recruitment of CD62L+ lymphocytes. In a mouse tumor model, induction of HEV-like vessels has been shown to allow naive lymphocyte recruitment, priming, and eradication of tumor cells. Therefore, although detrimental in chronic inflammatory diseases, presence of HEV-like vessels could be beneficial in human cancer. Indeed, we observed that within human tumors, HEV-like vessels were present in areas of effector memory CD8+ T lymphocytes infiltrates in close contact with mature dendritic cells. A better understanding of the molecular mechanisms controlling HEV Fosbretabulin order phenotype and functions may have important applications in cancer therapy for enhancing lymphocyte recruitment into tumors. Poster No.

Primers stm0551-F and stm0551-R external to stm0551 amplified a 0.5-kb DNA fragment from S. Typhimurium LB5010 genomic

DNA, while the same primer set generated a 1.3-kb DNA fragment from genomic DNA of the S. Typhimurium stm0551 mutant strain, indicating a kanamycin cassette inserted into the stm0551 gene. This DNA fragment was also sequenced to determine its identity. The confirmed stm0551 mutant strain was then designated S. Typhimurium Δstm0551. S. Typhimurium LB5010 mediated yeast agglutination and guinea pig erythrocyte when cultured in static LB broth, whereas agglutination was not detected when cells were collected from LB agar (Table 3). In contrast, the S. Typhimurium Δstm0551 strain mediated agglutination when grown on LB agar. Nonetheless the degree EPZ015938 datasheet of agglutination was not as strong as the same strain grown in static LB broth. Transformation of the pSTM0551 plasmid that contains the coding sequence of stm0551 conferred on S. Typhimurium Δstm0551 strain the ability to inhibit type 1 fimbrial expression in both culture conditions, while the S. Typhimurium Δstm0551 strain carrying a plasmid that possessed a stm0551 coding sequence with the glutamic acid (E) at position 49 replaced with an alanine (A), or a pACYC184 cloning

vector exhibited the same phenotype as the S. Typhimurium Δstm0551 strain. The Figure 3 demonstrated the yeast agglutination tests performed on glass slides. Table 1 Bacterial strains and plasmids used in this study Name Description a Lazertinib cell line Reference or source Salmonella enterica Foretinib in vivo serotype Typhimurium LB5010 Wild type S. enterica serotype Typhimurium LT2 strain, fimbriate with the complete fim gene cluster [21] Δstm0551 stm0551 deletion mutant; Kanr Present study Escherichia coli strain One Shot® TOP10 chemically competent E. coli F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG Invitrogen BL21Star™ (DE3) One Shot® chemically competent E. coli F- ompT hsdS B (rB – mB -) gal dcm (DE3) Invitrogen Plasmids pSTM0551 A 0.5-kb DNA fragment possessing the stm0551 coding sequence cloned into the pACYC184 vector; Cmr Present

study pSTM0551E49A Amobarbital A 0.5-kb DNA fragment possessing the stm0551 coding sequence with glutamic acid (E) at position 49 replaced with an alanine (A) cloned into the pACYC184 vector; Cmr Present study pACYC184 Tetr, Cmr, cloning vector; w/p15A ori ATCC, Manassas, VA pET101/D-TOPO Ampr, 6xHis tag expression vector Invitrogen pKD46 Ampr, express λ Red recombinase system, temp- sensitive replicon [22] pKD13 Plasmid carrying Kanr cassette [22] a Amp r ampicillin resistant; Cm r chloramphenicol resistant; Kan r kanamycin resistant; Tet r tetracycline resistant Table 2 Primers used in the present study Purpose and name Sequence (5′ to 3′) Description Construction of the stm0551 mutant stm0551pKD13-F GCTCTGATGTTTCAATGCCTTCCATCAGC ATTAACTGATTCCGGGGATCCGTCGACC Annealing Temp.

Cummings S, Eastell R, Ensrud KE, Reid selleck DM, Vukicevic S, La Croix A et al (2008) The effects of lasofoxifene on fractures and breast cancer: 3-year results from the PEARL trial. J Bone Miner Res 23:S81, Abstr. 1288 154. Downs R, Moffett AH, Ghosh A, Cox DA, Harper K (2008) Effects of arzoxifene on bone turnover and safety in postmenopausal women with low bone mass: results from a 6-month phase 2 study. J Bone Miner Res 23:S470–S471 155. Silverman

SL, Christiansen C, Genant HK, Vukicevic S, Zanchetta JR, de Villiers TJ, Constantiene GD, Chines AA (2008) Efficacy of bazedoxifene in reducing new vertebral fracture risk in postmenopausal women with osteoporosis: results from a 3-year, randomized, placebo-, and active-controlled clinical trial. J Bone Miner Res 23:1923–1934PubMedCrossRef 156. Stroup GB, Lark MW, Veber DF, Bhattacharyya A, Blake S, Dare LC, Erhard KF, Hoffman SJ, James IE, Marquis RW, Ru Y, GW-572016 research buy Vasko-Moser JA, Smith BR, Tomaszek T, Gowen M (2001) Potent and selective inhibition of human cathepsin K leads to inhibition PF-3084014 price of bone resorption in vivo in a nonhuman primate. J Bone Miner Res 16:1739–1746PubMedCrossRef 157. McClung MR, Bone H, Cosman E, Roux C, Verbruggen N, Hustad C, DaSilva C, Santora A, Ince A (2008) A randomized, double-blind, placebo-controlled

study of odanacatib (MK-822) in the treatment of postmenopausal women with low bone mineral density: 24-month results. J Bone Miner Res 23:S82 158. Li X, Ominski MS, Warmington KS, Morony S, Gong J, Cao J, Gao Y, Shalhoub V, Tipton B, Haldankar R, Chen Q, Winters A, Boone T, Geng Z, Niu QT, Ke HZ, Kostenuik PJ, Simonet WS, Lacey DL, Paszty C (2009) Sclerostin antibody treatment increases bone formation, bone mass and bone strength in a rat model of postmenopausal osteoporosis. J Bone Miner Res 24:578–588PubMedCrossRef”
“Dear Editors, We read with interest the article by Brennan et al. in the September issue of Osteoporosis International describing the association between socio-economic status and osteoporotic fracture in population-based Sirolimus chemical structure adults [1]. In this systematic review

they found a strong association between marital status and fracture, with those who were unmarried, single, divorced or widowed having the highest risk. However, they found conflicting data for an association between educational attainment or level of income and osteoporotic fracture, which they felt was surprising because of the ‘common assumption that participation in healthier lifestyles increases with higher income and educational attainment’. They suggest some potential explanations for this, but we would like to suggest an alternative. We carried out a large population-based study of the associations between socio-economic status and bone mass (one of the strongest predictors of osteoporotic fracture) in children [2] and found no overall association between highest educational achievement of the mother and bone mass of the offspring.

When A549 cells were grown to approximately 60-70% confluence, they were washed five times with SFM to remove albumin

and other elements contained in FBS. Cells were then either infected with 10 CFU/cell of M. pneumoniae in SFM or left untreated for further conditioned media (CM) collection. Cell viability in SFM was assessed by MTT test and trypan blue exclusion assay, and the cell death was assessed Selleckchem SHP099 by apoptosis assay using the Annexin V-FITC/PI Kit (Multiscience, Hangzhou, China). Sample preparation The CM was harvested 24 h after infection by centrifugation at 9,000 g for 15 min to remove floating cells and cellular debris, and filtered through a 0.22 μm filter (Chemicon, Millipore, MA, USA). After the APO866 in vitro addition of protease inhibitors (Inhibitor cocktail complete, Roche Diagnostics, Mannheim, Germany), the media was concentrated

using the Amicon Ultra-15 (Millipore) centrifugal filter devices with a 3,000-nomina-weight limit (NMWL). The supernatants were subsequently precipitated by acetone at -20°C overnight, and harvested by centrifugation at 16,000 g for 20 min. The protein pellets were dried in air and then resuspended in an appropriate volume of reducing solution containing 6 M urea, 2 M thiourea and 25 mM ammonium bicarbonate (Sigma, St Louis, MO). The protein concentrations were determined by the Bradford assay (Bio-Rad, Hercules, CA). 100 μg of each sample was reduced with 10 mM DTT (Sigma) at 37°C for 2.5 h, and then carbamidomethylated with 50 mM iodoacetamide (IAA) (Sigma) at room temperature in the dark for 40 min. Subsequently, digestion was performed by sequencing grade selleck chemicals llc trypsin (Promega, Madison, BCKDHA WI) using a 1:50 enzyme:protein

ratio at 37°C for 20 h. After digestion, samples were lyophilized under vacuum and kept at -80°C until use. Three independent experiments were performed and samples were prepared individually for further study. Total cell lysates from the A549 cells were prepared as previously described [3]. Briefly, cells were washed and detached on ice in phosphate-buffered saline (PBS), and lysed in cell lysis buffer containing 7 M urea, 2 M thiourea, 4% CHAPS, 65 mM DTT, and 0.2% biolyte (Bio-Rad). The lysates were frozen and thawed with liquid nitrogen three times, and then centrifuged for 1 h at 10,000 g to remove cellular debris. The supernatant was then collected for further Western blot analysis. LC-MS/MS All of the mass analyses were performed using a nano-LC-MS/MS system, which consisted of a nano-HPLC system (the Ettan MDLC system; GE Healthcare, Piscataway, NJ) and a linear trap quadruple (LTQ) mass spectrometer (LTQ VELOS; Thermo Finnigan, San Jose, CA) equipped with a nano-ESI source. A RP trap column (Zorbax 300SB-C18 peptide traps, Agilent Technologies, Wilmington, DE) was used for desalting of samples, and a C18 reverse-phase column (150 μm i.d., 150 mm length, Column Technology Inc., Fremont, CA) was used for separation. Mobile phase A consisted of HPLC-grade water containing 0.

Oikos 118:1174–1180CrossRef Kearns CA, Inouye DW, Waser NM (1998) Endangered mutualisms: the conservation of plant-pollinator interactions. Annu Rev Ecol Syst 29:83–112CrossRef Klein AM, Steffan-Dewenter I, Buchori D et al (2002) Effects of land-use intensity in tropical agroforestry systems on coffee flower-visiting and trap nesting bees and wasps. Conserv Biol 16:1003–1014CrossRef Klein AM, Steffan-Dewenter I, Tscharntke T (2003a) Fruit set of highland coffee increases with

the diversity of pollinating bees. Proc R Soc Lond B Biol Sci 270:955–961CrossRef Klein AM, Steffan-Dewenter I, Tscharntke T (2003b) Pollination of Coffea canephora in relation to local and regional agroforestry management. J Appl Ecol 40:837–845CrossRef Klein AM, NVP-BGJ398 datasheet Vaissière BE, Cane JH et al (2007) Importance LY2874455 of pollinators in changing landscapes for world crops. Proc R Soc Lond B Biol Sci 274:303–313CrossRef Kremen C, Williams NM, Thorp RW (2002) Crop pollination from native bees at risk from agricultural intensification. P Natl Acad Sci USA 99:16812–16816CrossRef Kremen C, Williams NM, Bugg RL et al (2004) The area

requirements of an ecosystem service: crop pollination by native bee communities in California. Ecol Lett 7:1109–1119CrossRef Lande R (1996) Statistics and partitioning of species diversity, and similarity among multiple communities. Oikos 76:5–13CrossRef Lindh BC (2005) Effects of conifer basal area on understory herb presence, abundance, and flowering in a second-growth Douglas-fir forest. Can J For Res 35:938–948CrossRef Liow LH, Sodhi NS, Elmqvist T (2001) Bee diversity along a disturbance

gradient in tropical lowland forests of south-east Asia. J Appl Ecol 38:180–192CrossRef Millennium Ecosystem Assessment (2005) In: Mace G, Masundire H, Baillie J (eds) Ecosystems and human well-being: current state and trends, Chap 4. Island Press, Washington, DC Perfecto I, Rice RA, Greenberg R et al (1996) Shade coffee: a disappearing refuge for biodiversity. Bioscience 46:598–608CrossRef Perfecto I, Armbrecht I, Philpott SM (2007) Shaded coffee and the stability of rainforest margins in northern Latin America. In: Tscharntke T, Leuschner C, Zeller M, Guhadja E, Bidin A et al (eds) Stability Aurora Kinase of tropical rainforest margins: linking ecological, economic and social constraints of land use and conservation. Springer, Berlin, pp 227–264 Potts SG, Petanidou T, Roberts S et al (2006) Plant pollinator biodiversity and pollination services in a complex Mediterranean landscape. Biol Conserv 129:519–529CrossRef Ricketts TH, Daily GC, Ehrlich PR et al (2001) Countryside biogeography of moths in a fragmented landscape: biodiversity in native and agricultural habitats. Conserv Biol 15:378–388CrossRef Ricketts TH, Regetz J, Steffan-Dewenter I et al (2008) Landscape effects on crop pollination services: are there general patterns? Ecol Lett 11:499–515CrossRefPubMed Sobek S, Tscharntke T, learn more Scherber C et al (2009) Canopy vs.